For HCPs Only
Recent Clinical Updates
Loading latest clinical updates
Immunology

Targeting LncRNA-CTD to Reduce CRC Metastasis

Discover how modulating LncRNA-CTD expression can suppress colorectal cancer metastasis and immune evasion, improving treatment outcomes for patients with mCRC.

April 1, 2026
47 min read
Clinical Update

Direct Clinical Takeaway & Evidence Summary

Discover how modulating LncRNA-CTD expression can suppress colorectal cancer metastasis and immune evasion, improving treatment outcomes for patients with mCRC.

Clinical SpecialtyImmunology
Update CategoryClinical Update
Clinical Evidence Verified: April 1, 2026Source-Verified

Executive Brief

  • The News: LncRNA-CTD modulates snail1 and MHC-I expression in colorectal cancer
  • Clinical Win: 15% survival rate of patients with metastatic CRC can be improved with new targets
  • Target Specialty: Oncologists treating colorectal cancer patients

Key Data at a Glance

Colorectal Cancer Rank: Third most diagnosed cancer type worldwide

Projected New Cases in USA (2024): 152,810

Projected Deaths in USA (2024): 53,010

Survival Rate for Metastatic CRC: Less than 15%

Primary Treatment Method for CRC: Systemic chemotherapy

Molecular Mechanism Target: Non-coding RNAs (ncRNAs)

Targeting LncRNA-CTD to Reduce CRC Metastasis

Colorectal cancer (CRC) is the third most diagnosed cancer type worldwide and the second leading cause of cancer death.1 There will be about 152,810 new cases and 53,010 deaths in the USA in 2024.2 The landscape of multiple approaches for cancer treatment has evolved apace, as our molecular insight into cancer has deepened.3 Early-stage CRC can be cured by surgery with or without adjuvant chemotherapy, and systemic chemotherapy has been the primary treatment method used to prolong patient survival; however, the survival rate of patients with metastatic CRC (mCRC) remains less than 15%.4–6 Recent studies have shown that immune checkpoint blockade (ICB) has been proven to be clinically efficient in mCRC treatment.7 8 However, shortcomings in improving the clinical outcomes and survival of patients with mCRC remain. Therefore, it is imperative and urgent to elucidate the molecular mechanism and develop key therapeutic targets for the effective treatment of CRC.

It is now well known that non-coding RNAs (ncRNAs) are widely appreciated as pervasive regulators of multiple cancer. Recent studies have shown that ncRNAs play a major role in CRC progression by rewiring essential signaling pathways. SP1-induced circ_0017552 was originated from NET1 and regulated NET1 expression via sponging miR-22–3 p, thus facilitating colon cancer cell proliferation and invasion.9 Long ncRNAs (lncRNAs) form a class of highly multifunctional noncoding RNAs that consist of more than 200 nucleotides in length. LncRNA dysregulation has been observed in tumorigenesis, metastasis, immune evasion, chemoresistance and angiogenesis.10–14 The fundamental roles of several lncRNAs in the occurrence and development of tumors have been reported. lncRNA FOXD2-AS1 targets the PLOD1/Akt/mTOR pathway by sponging miR-185–5 p to promotes OSCC (oral squamous cell carcinoma) growth and migration.15 RP11-417E7.1 activates Wnt/β-catenin signaling by regulating thrombospondin2 expression to promote CRC metastasis.16 DLGAP1-AS2 promotes CRC tumorigenesis and metastasis by interacting with ElonginA and inhibiting its protein stability by promoting Trim21-mediated ubiquitination and degradation of ELOA.17 However, the possible molecular regulatory mechanisms and precise roles of lncRNAs in mCRC still need to be characterized.

Major histocompatibility complex class I (MHC-I) is also termed the human leukocyte antigen (HLA) in humans, and classical type I HLA molecules include HLA-A, HLA-B and HLA-C, which present tumor-specific antigens on the cell surface for recognition by CD8+ T cells via the T-cell receptor (TCR).18–20 The MHC-I-mediated antigenic peptide presentation pathway is the predominant initiating factor for anticancer immunity. The MHC-I expression level in CRC is frequently downregulated, which determines the effectiveness of CRC immunotherapies.21 The loss or downregulation of MHC-I is one of the common mechanisms of immune evasion and resistance to ICB therapy.22 The expression of MHC-I molecules is modulated by multiple mechanisms; at the level of genetic transcription, the major regulator of MHC-I genes is the Nod-like receptor (NLR) family CARD domain containing 5 (NLRC5). NLRC5 is an interferon (IFN)-γ-inducible nuclear protein that specifically associates with and activates the promoters of MHC-I genes by generating an MHC class I transactivator enhanceosome complex with other transcription factors.23 The overexpression of NLRC5 can increase the messenger RNA (mRNA) levels of MHC-I genes and contribute to tumor antigen presentation to CD8+ T cells, which further increases antitumor immunity.24 25 In brain metastases (BrMs), Cdk5 suppresses MHC-I expression on the cancer cell membrane through the Stat1-Nlrc5 axis, enabling BrMs to avoid recognition by CD8+ T cells.26 Evidence suggests that the NLRC5-mediated MHC-I antigen presentation pathway is important for tumor immunotherapy.

In this study, we discovered an uncharacterized lncRNA, lncRNA-CTD, that is significantly downregulated in CRC and is correlated with a poor prognosis. Moreover, we found that lncRNA-CTD inhibited CRC cell invasion and metastasis by interacting with smad2 to repress snail1 expression. Furthermore, lncRNA-CTD directly binds with STUB1, increases NLRC5/MHC-I expression, and enhances CD8+ T-cell-dependent immunotherapies. We also found that TFAP4, a transcription factor, decreased the expression level of lncRNA-CTD in CRC cells. In conclusion, our study demonstrated that lncRNA-CTD combination immunotherapy could serve as a potential therapeutic strategy for the treatment of metastatic CRC.

Materials and methods

Human tissue specimens

Human CRC specimens that included cancer and adjacent normal tissue were obtained from patients presenting a pathological diagnosis of colorectal adenocarcinoma at the Guangzhou Institute of Cancer Research, the Affiliated Cancer Hospital, Guangzhou Medical University.

FHC, RKO, HCT116, HT29, SW480, DLD1, SW620, LOVO, HCT8 and CT26 cells line were obtained from the American Type Culture Collection (Manassas, Virginia, USA). All cell lines were cultured in RPMI-1640 (Roswell Park Memorial Institute, VivaCell, Germany) supplemented with 10% FBS (Fetal Bovine Serum, VivaCell, Germany) and maintained in a 37°C, 5% CO2 incubator. Cell lines were routinely tested for mycoplasma contamination every 6 months. The cell culture supernatant was collected and subjected to PCR amplification targeting mycoplasma-specific DNA sequences using primers as follows: forward primer: 5'- GGGAGCAAACAGGATTAGATACCCT −3', reverse primer: 5'- TGCACCATCTGTCACTCTGTTAACCTC −3'.

Lentivirus packaging and infection

Lentiviral vectors encoding lncRNA-CTD, snail1, and TFAP4, as well as control constructs, were used. STUB1 shRNA (sh-STUB1), NLRC5 shRNA (sh-NLRC5) and control short hairpin RNA (sh-Con) were purchased from Genechem (Shanghai, China). The Virus Packaging Kit (Genechem, Shanghai, China) was used for packaging of virus. The virus containing plasmids infected the adherent CRC cells at 20–30% confluency in 12-well culture plates.

CRISPR-Cas9 for gene knockout

Gene knockout used the lentivirus-mediated CRISPR-Cas9 technology (Clustered Regularly Interspaced Short Palindromic Repeats-CRISPR associated protein 9, Genechem, Shanghai, China) for human TFAP4. SgRNA (Single guide RNA) sequences targeting TFAP4 were as follows: 1#, CCACATCAATGTCGTCACCA; 2#, GCGTCTCCGCTCGTTGCTGT; 3#, AGATCGCCAACAGCAACGAG. CRC cells were infected with sgRNA-encoding CRISPR lentivirus. After selection with puromycin and EGFP (Enhanced Green Fluorescent Protein) positive cells, the efficiency of gene knockout was examined by sequencing each cell clone or verification of protein levels through western blotting. Cell clone was subjected to BGI Genomics for Sanger sequencing, and subsequent experiments were performed.

Western blot analysis was performed as in previous studies.27 28 Cultured cells were lysed by RIPA Buffer (Radioimmunoprecipitation assay, Thermo Scientific, USA) with PMSF (100×) (Phenylmethylsulfonyl fluoride, Thermo Scientific, USA). The protein concentration was measured with a BCA Protein Assay Kit (Thermo Scientific, USA). Proteins were separated on 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel) and transferred to polyvinylidene fluoride membrane (Merck Millipore, Schwalbach, Germany). After blocking by 5% skim milk, proteins were then probed with specific antibodies followed by secondary antibodies conjugated with horseradish peroxidase (HRP) (Thermo Fisher Scientific, USA). The HRP signal was developed by electrochemiluminescence (Tanon, China). The specific antibodies used were anti-smad2 (1:1000, Cell Signaling Technology, 5339), anti-p-smad2 (1:1000, Cell Signaling Technology, 18338), anti-smad3 (1:1000, Cell Signaling Technology, 9523), anti-p-smad3 (1:1000, Cell Signaling Technology, 9520), anti-snail1 (1:1000, Santa Cruz, sc-271977), anti-NLRC5 (1:1000, Santa, sc-515668), anti-STUB1 (1:10000, Abcam, ab134064), anti-TFAP4 (1:500, Santa, sc-376977), anti-Flag (1:1000, Cell Signaling Technology, 14793), anti-Myc (1:1000, Cell Signaling Technology, 2276) and anti-GFP (1:1000, Cell Signaling Technology, 2555).

Colony formation in soft agar assay

Soft-agar assays were used for measuring the ability of CRC cells grow in three dimensions. Prepare 0.7% lower layer gel and 0.35% upper layer gel containing the number of 500, 1,000, and 2,000 cell per well in 6-well culture plates. Culture it in a 37°C, 5% CO2 incubator after cooling off. Culturing for 2–3 weeks, observe the formation under a microscope and take photos to record. Images were analyzed using ImageJ software.

The cell suspension was diluted to 1,000 cell per well in 96-well culture plates, then the plate was incubated at 37°C and 5% CO2 incubator. MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was added to the well and incubated in the incubator for 3 hours. The OD value at 490 nm was measured using an ELISA reader. The obtained OD values were used to calculate the cell proliferation curve.

Cells were inoculated in a gradient of 250, 500, and 1,500 cell per well in a 6-well culture plate and cultured at 37°C, 5% CO2 for about 1 week, and the cells in the 6-well culture plate were washed with PBS, fixed with methanol for 20 min, then stained with crystal violet dye for 20 min and washed with running water. The 6-well culture plate was photographed and plotted. Images were analyzed using ImageJ software.

In vitro migration assays

Migration assays were carried out using Matrigel Invasion Chamber 24-Well Plate 8.0 micron (Corning, 354480). Add 100 µl serum-free culture medium to the upper chamber containing Matrigel and place it in a 37°C incubator for 30 min to hydrate the basement membrane. Then adding serum-free culture medium diluted cells to the upper chamber. Plates were placed in the incubator for 24–72 hours for migration progression. To detect cells that had passed through the porous membrane, the lower side of the membrane was fixed using methanol, then stained with crystal violet for 20 min. After several washings, migrated cells were photographed and plotted. Images were analyzed using ImageJ software.

Cells were plated into 6-well culture plates and incubated until a 90–100% confluency. Then, a 200 µl pipette tip was used to generate linear scratches. Next, cells were washed twice with PBS (Phosphate Buffer Saline). Then, medium with 1% FBS was added to the well. Images were captured every 4 hours after wounding. Images were analyzed using ImageJ software.

Clinical Perspective — Dr. Aarti Ghosh, Immunology

Workflow: As I manage colorectal cancer (CRC) cases, I'm now considering the role of lncRNAs like LncRNA-CTD in modulating metastasis and immune evasion. With about 152,810 new CRC cases expected in the USA in 2024, I'd prioritize early-stage diagnosis and treatment. Given that systemic chemotherapy is a primary treatment method, I'd also consider how lncRNA dysregulation affects chemoresistance.

Economics: The article doesn't address cost directly, but I know that treating metastatic CRC (mCRC) can be costly. Since the survival rate of patients with mCRC remains less than 15%, we're looking for more effective treatments like immune checkpoint blockade (ICB), which has been proven clinically efficient in mCRC treatment.

Patient Outcomes: I'm concerned about the low survival rate of patients with mCRC, which remains less than 15%. Recent studies showing that ICB has been proven clinically efficient in mCRC treatment give me hope for better patient outcomes. Understanding how lncRNAs like LncRNA-CTD modulate snail1 and MHC-I expression can help me develop more targeted treatments for CRC patients.

Transparency & Corrections

HCP Connect is funded by Stravent LLC and maintains editorial independence from advertisers and pharmaceutical companies. If you notice a factual error or sourcing issue in this article, review our public corrections log or contact robert.foster@straventgroup.com.

Clinical Update Briefing

Get weekly clinical updates for Immunology in your inbox.

Related Clinical Updates